NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance. The NCERT solutions for Class 11 Mathematics have been made by Mathematics teacher of one of the best CBSE school in India. These NCERT solutions have been made to give detailed answers and expanations of the concepts as per NCERT which can be easily understood by the students. Refer to other links also to download mathematics NCERT solutions, worksheets, sample papers and Exemplar Solutions. 

Class 12 Biology

NCERT Solutions

Chapter 6 Molecular Basis of Inheritance

1.Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine,Guanosine, Uracil and Cytosine.

Ans. Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2.If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Ans. In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:

5′-ATGCATGCATGCATGCATGCA

TGCATGC-3′

Write down the sequence of complementary strand in 5′ -> 3′ direction.

Ans. 5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

4.If the sequence of the coding strand in a transcription unit is written as follows: 5-

ATGCATGCATGCATGCATGCA TGCATGC-3′ Write down the sequence of mRNA.

Ans. mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5.Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans. Complementary base pairing property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of double helix of DNA molecule. Such an arrangement of DNA molecule led them to hypothesize the semi conservative mode of replication of DNA.

Please click the link below to download NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance.

Tags: 

 


Click to View or Download pdf file
Click for more Biology Study Material

Latest NCERT & CBSE News

Read the latest news and announcements from NCERT and CBSE below. Important updates relating to your studies which will help you to keep yourself updated with latest happenings in school level education. Keep yourself updated with all latest news and also read articles from teachers which will help you to improve your studies, increase motivation level and promote faster learning

Critical notice issued by CBSE relating to Boards and other classes

Critical notice issued by CBSE relating to Boards and other classes

Live session by CBSE Experts for holistic wellbeing

CBSE and Fit India Mission have collaborated to provide live sessions by experts covering a range of topics for holistic well-being of school going children, which will include simple actionable tips around Basic Exercises, Nutrition, Yoga & Meditation, boosting...

CBSE Recommends Arogya Setu App

Written recommendation from CBSE to school principals for initiating the Arogya Setu App! The Central Board of Secondary Education has advised to all school principals through a written communication recommending the “Arogya Setu App” and Health Ministry's protocol for...

CBSE Recommends Arogya Setu App, Writes To School Principals

Written recommendation from CBSE to school principals for initiating the Arogya Setu App! New Delhi:  The Central Board of Secondary Education has advised all school principals through a written communication recommending the “Arogya Setu App” and Health Ministry's...

TV Channels for Students by CBSE

In enhancing the students studying part, the Government is planning to introduce one standard one channel plan. The lockdown in India has adversely collapsed all the operations including schools, colleges, and workplaces with unanticipated setbacks. On behalf of the...

CBSE Board 2020 Important announcement regarding rescheduling of Class 10 12 Board Exams

CBSE Board Exams 2020: Here's when Board will organize the CBSE Class X and Class XII Board Exams.   All the candidates appearing for CBSE Standard X and Standard XII Board Exams 2020 can cross-check the essential notice released by the board concerning the...

×
Studies Today