NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance

Scroll down for PDF

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance. The NCERT solutions for Class 11 Mathematics have been made by Mathematics teacher of one of the best CBSE school in India. These NCERT solutions have been made to give detailed answers and expanations of the concepts as per NCERT which can be easily understood by the students. Refer to other links also to download mathematics NCERT solutions, worksheets, sample papers and Exemplar Solutions. 

Class 12 Biology

NCERT Solutions

Chapter 6 Molecular Basis of Inheritance

1.Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine,Guanosine, Uracil and Cytosine.

Ans. Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2.If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Ans. In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:

5′-ATGCATGCATGCATGCATGCA

TGCATGC-3′

Write down the sequence of complementary strand in 5′ -> 3′ direction.

Ans. 5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

4.If the sequence of the coding strand in a transcription unit is written as follows: 5-

ATGCATGCATGCATGCATGCA TGCATGC-3′ Write down the sequence of mRNA.

Ans. mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5.Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans. Complementary base pairing property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of double helix of DNA molecule. Such an arrangement of DNA molecule led them to hypothesize the semi conservative mode of replication of DNA.

Please click the link below to download NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance.

Tags: 


Click on the text For more study material for Biology please click here - Biology

Latest NCERT & CBSE News

Read the latest news and announcements from NCERT and CBSE below. Important updates relating to your studies which will help you to keep yourself updated with latest happenings in school level education. Keep yourself updated with all latest news and also read articles from teachers which will help you to improve your studies, increase motivation level and promote faster learning

CBSE Instructs schools to form Eco Clubs

The Central Board of Secondary Education has directed schools to form Eco Clubs under the Board for Environmental Protection. They have further asked the schools to ensure that every student would save one litre of water at home and school every day. It was started by...

Top Classroom Challenges According to the Teachers

Teacher plays a major role in our lives in the classrooms. Not only is studying, but the teacher also serves many other roles in the classrooms. A teacher is always a role model for a student who can inspire him to live a better future life. Besides this, life of a...

CBSE class 10, 12 board exam important information

CBSE class 10, 12 board exam: important information to prevent problems for students : The Central Board of Secondary Education (CBSE) has issued an advisory for the students of class 10 and class 12 board. As per the notice, the registration of students appearing in...

CBSE will have more practicals

CBSE board has made a bigger announcement regarding 2020 board examinations for class 12. Board has decided that subjects like humanities, History, English and Hindi will also have practical exams like Chemistry, Biology, and Physics. As per, CBSE official's statement...

CBSE Board Practical Exam 2020

CBSE Board Practical Exam 2020: Important changes in date sheet, internal/external examiners and more Are you doing preparations for class 10 and 12 CBSE board exams? If yes, then you have to see what major changes CBSE has brought in the CBSE date sheet for class 10...

What Is The Secret Of Choosing A Good Tutor For Your Child?

Is your child lost in the maze of syllabus, chapters, millions of topics and huge books? Does your child feel lost in a class filled with many students? Is your child unable to bring in the best results? Well, then, you definitely need to find some alternative...

×
Studies Today