NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance. The NCERT solutions for Class 11 Mathematics have been made by Mathematics teacher of one of the best CBSE school in India. These NCERT solutions have been made to give detailed answers and expanations of the concepts as per NCERT which can be easily understood by the students. Refer to other links also to download mathematics NCERT solutions, worksheets, sample papers and Exemplar Solutions. 

Class 12 Biology

NCERT Solutions

Chapter 6 Molecular Basis of Inheritance

1.Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine,Guanosine, Uracil and Cytosine.

Ans. Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2.If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Ans. In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:

5′-ATGCATGCATGCATGCATGCA

TGCATGC-3′

Write down the sequence of complementary strand in 5′ -> 3′ direction.

Ans. 5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

4.If the sequence of the coding strand in a transcription unit is written as follows: 5-

ATGCATGCATGCATGCATGCA TGCATGC-3′ Write down the sequence of mRNA.

Ans. mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5.Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans. Complementary base pairing property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of double helix of DNA molecule. Such an arrangement of DNA molecule led them to hypothesize the semi conservative mode of replication of DNA.

Please click the link below to download NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance.

Tags: 

 


Click to View or Download pdf file
Click for more Biology Study Material

Latest NCERT & CBSE News

Read the latest news and announcements from NCERT and CBSE below. Important updates relating to your studies which will help you to keep yourself updated with latest happenings in school level education. Keep yourself updated with all latest news and also read articles from teachers which will help you to improve your studies, increase motivation level and promote faster learning

Class 10 Boards Cancelled Class 12 postponed

Looking to the present situation of the pandemic and school closures, and also taking in account the safety and well-being of the students, it is decided as follows:   1. The Board Exams for Class XIIth to be held from May 4th to June, 14th, 2021 are hereby postponed....

CBSE Assessment Framework

The Central Board of Secondary Education (CBSE) today, announced a suggested competency-based assessment framework to strengthen India’s existing school education system for secondary level (classes 6-10) and improve the overall learning outcomes of students across...

Latest CBSE Syllabus for 2021 2022 PDF Download

Latest Syllabus for Class 12 for 2021 2022 Latest Syllabus for Class 11 for 2021 2022 Latest Syllabus for Class 10 for 2021 2022 Latest Syllabus for Class 9 for 2021 2022 CBSE has issued the latest syllabus for the academic year 2021 2022 which is applicable for all...

Time management for CBSE students

The first thing to learn about Time Management is that time is theoretical so you can’t really manage it. What you do when you get into time management, is that you manage yourself. You decide what has to be done, when it must be done and how to do it in the stipulated...

ICSE Board Exams Cancelled

The ICSE (Class X) 2021 Examination: Given the present worsening situation of the Covid- 19 Pandemic in the country, the CISCE has decided to CANCEL the ICSE (Class X) 2021 Examination. The options given in the earlier Circular dated 16th April 2021, now stands...

×
Studies Today