CBSE Class 12 Biology Worksheet Set 02 Solved

Download Class 12 Biology Worksheets for All Chapters

Explore reliable practice materials for All Chapters tailored for Class 12 learners. Utilizing these Biology worksheets ensures thorough preparation and strengthens problem-solving speed for upcoming school assessments.

Access All Chapters Questions and Exercises

View or download the dedicated All Chapters practice resource below. Engaging with these objective and subjective questions daily ensures continuous academic progress and mastery of the 2026-27 curriculum.

1. Lactose is considered an inducer in lac operon. Give reason.
 
2. What do you mean by biogenesis? 
 
3. If the sequence of the coding strand in a transcription unit is written as follows:
5- ATCGATCGATCGATCGATCGATCGATCG – 3 Write the sequence of mRNA transcribed from it.
 
4. Expand Eco R1. 
 
5. Describe the isolation of DNA from bacterial cell.
 
6. Explain any two methods of vector less gene transfer. 
 
7. Why hn RNA needs to undergo splicing? 
 
8. Differentiate between the theories of Charles Darwin and Hugo de Vries regarding evolution.
 
OR
 
What is founder effect? List any two factors affecting Hardy Weinberg equilibrium.
 
9. Describe two salient features of genetic code. 
 
10. Explain Nucleosome model of chromosome with a neat labeled diagram.
 
OR
 
List any 3 salient features of Double Helix model of DNA.
 
11. Discuss different steps involved in the process of amplification of DNA.
 
OR
 
Explain how β galactosidase site acts as selectable marker.
 

Please click on below link to download CBSE Class 12 Biology Worksheet Set B Solved

Free study material for Biology

All Chapters Practice Sheet and Solutions for Class 12 Biology

All Chapters Printable Worksheet for Class 12 Biology

Access structured practice worksheets for All Chapters designed in alignment with the latest CBSE curriculum for Class 12 Biology. These printable problem sets help students build accuracy and prepare effectively for school tests.

How to Use These Practice Sheets

Cross-reference your completed exercises with comprehensive NCERT solutions for Class 12 Biology to ensure absolute clarity across all sub-topics in this chapter.

Enhance Speed with Online Practice

Explore our broader library of printable assignments, chapter notes, and mock tests designed to support continuous revision and secure higher marks in CBSE assessments.

FAQs

Where can I download the latest PDF for CBSE Class 12 Biology Worksheet Set 02 Solved?

You can download the teacher-verified PDF for CBSE Class 12 Biology Worksheet Set 02 Solved from StudiesToday.com. These practice sheets for Class 12 Biology are designed as per the latest CBSE academic session.

Are these Biology Class 12 worksheets based on the 2026-27 competency-based pattern?

Yes, our CBSE Class 12 Biology Worksheet Set 02 Solved includes a variety of questions like Case-based studies, Assertion-Reasoning, and MCQs as per the 50% competency-based weightage in the latest curriculum for Class 12.

Do you provide solved answers for CBSE Class 12 Biology Worksheet Set 02 Solved?

Yes, we have provided detailed solutions for CBSE Class 12 Biology Worksheet Set 02 Solved to help Class 12 and follow the official CBSE marking scheme.

How does solving CBSE Class 12 Biology Worksheet Set 02 Solved help in exam preparation?

Daily practice with these Biology worksheets helps in identifying understanding gaps. It also improves question solving speed and ensures that Class 12 students get more marks in CBSE exams.

Is there any charge for the Class 12 Biology practice test papers?

All our Class 12 Biology practice test papers and worksheets are available for free download in mobile-friendly PDF format. You can access CBSE Class 12 Biology Worksheet Set 02 Solved without any registration.