Refer to CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set C provided below available for download in Pdf. The MCQ Questions for Class 12 Biology with answers are aligned as per the latest syllabus and exam pattern suggested by CBSE, NCERT and KVS. Chapter 5 Molecular Basis of Inheritance Class 12 MCQ are an important part of exams for Class 12 Biology and if practiced properly can help you to improve your understanding and get higher marks. Refer to more Chapter-wise MCQs for CBSE Class 12 Biology and also download more latest study material for all subjects
MCQ for Class 12 Biology Chapter 5 Molecular Basis of Inheritance
Class 12 Biology students should refer to the following multiple-choice questions with answers for Chapter 5 Molecular Basis of Inheritance in Class 12.
Chapter 5 Molecular Basis of Inheritance MCQ Questions Class 12 Biology with Answers
Question. Purines found both in DNA and RNA are
a) cytosine and thymine
b) adenine and thymine
c) adenine and guanine
d) guanine and cytosine.
Answer : C
Question. Which of the following is initiation codon?
a) UAG
b) AUC
c) AUG
d) CCU
Answer : C
Question. Genes which are active all the time synthesizing substances needed by the cell are called
a) Cellular luxury genes
b) metabolic genes
c) house keeping genes
d) control genes
Answer : C
Question. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes
a) RNA polymerase II
b) RNA primase
c) RNA polymerase III
d) RNA polymerase I
Answer : A
Question. Ribosomal RNA is actively synthesised in
a) lysosomes
b) nucleolus
c) nucleoplasm
d) ribosomes.
Answer : B
Question. In DNA helix, cytosine is paired with guanine by
a) covalent bond
b) phosphate bond
c) three hydrogen bonds
d) two hydrogen bonds
Answer : C
Question. Protein synthesis in an animal cell, takes place
a) in the cytoplasm as well as endoplasmic reticulum
b) only on ribose attached to nucleon
c) only in the cytoplasm
d) in the nucleolus as well as in the cytoplasm.
Answer : D
Question. All of the following are part of an operon except
a) an operator
b) structural genes
c) an enhancer
d) a promoter.
Answer : C
Question. In DNA, when AGCT occurs, their association is as per which of the following pair?
a) AT-GC
b) AG-CT
c) AC-GT
d) All of these
Answer : A
Question. In three dimensional view the molecule of tRNA is
a) L-shaped
b) S-shaped
c) Y-shaped
d) E-shaped.
Answer : A
Question. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG
Answer : B
Question. ‘Lac operon’ in E. coli, is induced by
a) ‘I’ gene
b) promoter gene
c) β-galactosidase
d) lactose.
Answer : C
Question. The following ratio is generally constant for a given species:
a) A + G / C + T
b) T + C / G + A
c) G + C / A + T
d) A + C / T + G.
Answer : C
Question. In prokaryotes, the genetic material is
a) linear DNA without histones
b) circular DNA without histones
c) linear DNA with histones
d) circular DNA with histones.
Answer : B
Question. Cistron is
a) The coding sequence of DNA
b) The functional unit of DNA molecule that codes for a particular gene product
c) Intervening non coding sequence of DNA
d) The sequences which are removed during RNA splicing.
Answer : B
Question. Read the statements given below and identify the incorrect statement.
a) The human genome contains 3164.7 million nucleotide bases.
b) The average gene consists of 30,000 bp
c) The total number of genes is estimated at 30,000.
d) Chromosome Y has 231 genes
e) Less than 2% of the genome codes for proteins.
Answer : B
Question. Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originate as adaptation. These imprints need to be used
a) on plates with and without streptomycin
b) on plates with minimal medium
c) only on plates with streptomycin
d) only on plates without streptomycin.
Answer : C
Question. In E. coli, during lactose metabolism repressor binds to
a) regulator gene
b) operator gene
c) structural gene
d) promoter gene.
Answer : B
Question. The stretch of codons between AUG and a stop codon is called
a) open reading frame
b) TATA box
c) colinearity
d) degenerate
Answer : A
Question. If a DNA contains 1000 base pairs, what would be its length?
a) 3400 Å
b) 34000 Å
c) 6800
d) 1000 Å
Answer : A
Question. Peptidyl transferase
a) Is a 23s rRNA
b) forms peptide bonds
c) component of ribosome
d) all the three
Answer : D
Question. Experimental material in the study of DNA replication has been
a) Escherichia coli
b) Neurospora crassa
c) Pneumococcus
d) Drosophila melanogaster.
Answer : A
Question. Which one of the following statements about the particular entity is true ?
a) Centromere is found in animal cells, which produces aster during cell division.
b) The gene for producing insulin is present in every body cell.
c) Nucleosome is formed of nucleotides.
d) DNA consists of core of eight histones
Answer : B
Question. One turn of the helix in a B-form DNA is approximately
a) 2 nm
b) 20 nm
c) 0.34 nm
d) 3.4 nm.
Answer : D
Question. DNA synthesis can be specifically measured by estimating the incorporation of radio-labelled
a) thymidine
b) deoxyribose sugar
c) uracil
d) adenine.
Answer : A
Question. If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA
a) 30%
b) 10%
c) 90%
d) 40%
Answer : A
Question. Which of the following reunites the exon segments after RNA splicing?
a) RNA polymerase
b) RNA primase
c) RNA ligase
d) RNA proteoses
Answer : C
Question. If the DNA codons are ATG ATG ATG and a cytosine base is inserted at the beginning, then which of the following will result?
a) CAT GAT GAT G
b) A non-sense mutation
c) C ATG ATG ATG
d) CA TGA TGA TG
Answer : A
Question. Structural and catalytic role is of which RNA?
a) m RNA
b) t RNA
c) r RNA
d) hn RNA
Answer : C
Question. The final proof for DNA as the genetic material came from the experiments of
a) Hershey and Chase
b) Avery, MacLeod and McCarty
c) Hargobind Khorana
d) Griffith.
Answer : A
| CBSE Class 12 Biology Reproductive Health MCQs Set A |
| CBSE Class 12 Biology Reproductive Health MCQs Set B |
| CBSE Class 12 Biology Reproductive Health MCQs Set C |
| CBSE Class 12 Biology Ecosystem MCQs Set A |
| CBSE Class 12 Biology Ecosystem MCQs Set B |
| CBSE Class 12 Biology Ecosystem MCQs Set C |
MCQs for Chapter 5 Molecular Basis of Inheritance Biology Class 12
Expert teachers of studiestoday have referred to NCERT book for Class 12 Biology to develop the Biology Class 12 MCQs. If you download MCQs with answers for the above chapter you will get higher and better marks in Class 12 test and exams in the current year as you will be able to have stronger understanding of all concepts. Daily Multiple Choice Questions practice of Biology will help students to have stronger understanding of all concepts and also make them expert on all critical topics. After solving the questions given in the MCQs which have been developed as per latest books also refer to the NCERT solutions for Class 12 Biology. We have also provided lot of MCQ questions for Class 12 Biology so that you can solve questions relating to all topics given in each chapter. After solving these you should also refer to Class 12 Biology MCQ Test for the same chapter.
You can download the CBSE MCQs for Class 12 Biology Chapter 5 Molecular Basis of Inheritance for latest session from StudiesToday.com
Yes, the MCQs issued by CBSE for Class 12 Biology Chapter 5 Molecular Basis of Inheritance have been made available here for latest academic session
You can find CBSE Class 12 Biology Chapter 5 Molecular Basis of Inheritance MCQs on educational websites like studiestoday.com, online tutoring platforms, and in sample question papers provided on this website.
To prepare for Chapter 5 Molecular Basis of Inheritance MCQs, refer to the concepts links provided by our teachers and download sample papers for free.
Yes, there are many online resources that we have provided on studiestoday.com available such as practice worksheets, question papers, and online tests for learning MCQs for Class 12 Biology Chapter 5 Molecular Basis of Inheritance
