CBSE Class 12 Biology Molecular Basis of Inheritance MCQs Set 03

Question. Purines found both in DNA and RNA are
a) cytosine and thymine
b) adenine and thymine
c) adenine and guanine
d) guanine and cytosine.

Answer : C

Question. Which of the following is initiation codon?
a) UAG
b) AUC
c) AUG
d) CCU

Answer : C

Question. Genes which are active all the time synthesizing substances needed by the cell are called
a) Cellular luxury genes
b) metabolic genes
c) house keeping genes
d) control genes

Answer : C

Question. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes
a) RNA polymerase II
b) RNA primase
c) RNA polymerase III
d) RNA polymerase I

Answer : A

Question. Ribosomal RNA is actively synthesised in
a) lysosomes
b) nucleolus
c) nucleoplasm
d) ribosomes.

Answer : B

Question. In DNA helix, cytosine is paired with guanine by
a) covalent bond
b) phosphate bond
c) three hydrogen bonds
d) two hydrogen bonds

Answer : C

Question. Protein synthesis in an animal cell, takes place
a) in the cytoplasm as well as endoplasmic reticulum
b) only on ribose attached to nucleon
c) only in the cytoplasm
d) in the nucleolus as well as in the cytoplasm.

Answer : D

Question. All of the following are part of an operon except
a) an operator
b) structural genes
c) an enhancer
d) a promoter.

Answer : C

Question. In DNA, when AGCT occurs, their association is as per which of the following pair?
a) AT-GC
b) AG-CT
c) AC-GT
d) All of these

Answer : A

Question. In three dimensional view the molecule of tRNA is
a) L-shaped
b) S-shaped
c) Y-shaped
d) E-shaped.

Answer : A

Question. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG

Answer : B

Question. ‘Lac operon’ in E. coli, is induced by
a) ‘I’ gene
b) promoter gene
c) β-galactosidase
d) lactose.

Answer : C

Question. The following ratio is generally constant for a given species:
a) A + G / C + T
b) T + C / G + A
c) G + C / A + T
d) A + C / T + G.

Answer : C

Question. In prokaryotes, the genetic material is
a) linear DNA without histones
b) circular DNA without histones
c) linear DNA with histones
d) circular DNA with histones.

Answer : B

Question. Cistron is
a) The coding sequence of DNA
b) The functional unit of DNA molecule that codes for a particular gene product
c) Intervening non coding sequence of DNA
d) The sequences which are removed during RNA splicing.

Answer : B

Question. Read the statements given below and identify the incorrect statement.
a) The human genome contains 3164.7 million nucleotide bases.
b) The average gene consists of 30,000 bp
c) The total number of genes is estimated at 30,000.
d) Chromosome Y has 231 genes
e) Less than 2% of the genome codes for proteins.

Answer : B

Question. Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originate as adaptation. These imprints need to be used
a) on plates with and without streptomycin
b) on plates with minimal medium
c) only on plates with streptomycin
d) only on plates without streptomycin.

Answer : C

Question. In E. coli, during lactose metabolism repressor binds to
a) regulator gene
b) operator gene
c) structural gene
d) promoter gene.

Answer : B

Question. The stretch of codons between AUG and a stop codon is called
a) open reading frame
b) TATA box
c) colinearity
d) degenerate

Answer : A

Question. If a DNA contains 1000 base pairs, what would be its length?
a) 3400 Å
b) 34000 Å
c) 6800
d) 1000 Å

Answer : A

Question. Peptidyl transferase
a) Is a 23s rRNA
b) forms peptide bonds
c) component of ribosome
d) all the three

Answer : D

Question. Experimental material in the study of DNA replication has been
a) Escherichia coli
b) Neurospora crassa
c) Pneumococcus
d) Drosophila melanogaster.

Answer : A

Question. Which one of the following statements about the particular entity is true ?
a) Centromere is found in animal cells, which produces aster during cell division.
b) The gene for producing insulin is present in every body cell.
c) Nucleosome is formed of nucleotides.
d) DNA consists of core of eight histones

Answer : B

Question. One turn of the helix in a B-form DNA is approximately
a) 2 nm
b) 20 nm
c) 0.34 nm
d) 3.4 nm.

Answer : D

Question. DNA synthesis can be specifically measured by estimating the incorporation of radio-labelled
a) thymidine
b) deoxyribose sugar
c) uracil
d) adenine.

Answer : A

Question. If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA
a) 30%
b) 10%
c) 90%
d) 40%

Answer : A

Question. Which of the following reunites the exon segments after RNA splicing?
a) RNA polymerase
b) RNA primase
c) RNA ligase
d) RNA proteoses

Answer : C

Question. If the DNA codons are ATG ATG ATG and a cytosine base is inserted at the beginning, then which of the following will result?
a) CAT GAT GAT G
b) A non-sense mutation
c) C ATG ATG ATG
d) CA TGA TGA TG

Answer : A

Question. Structural and catalytic role is of which RNA?
a) m RNA
b) t RNA
c) r RNA
d) hn RNA

Answer : C

Question. The final proof for DNA as the genetic material came from the experiments of
a) Hershey and Chase
b) Avery, MacLeod and McCarty
c) Hargobind Khorana
d) Griffith.

Answer : A

Question: The E. Coli used by Meselson and Stahl for proving semiconservative nature of replication were initially grown in medium containing
a) 35S
b) 15NH4Cl
c) 32P
d) 15C
Answer: b

Question: During transcription base pairing between DNA template strand and new RNA strand is
a) A–T, G–C
b) A–C, G–T
c) A–G, T–C
d) None of these
Answer: d

Question: Main enzyme for transcription is
a) RNA dependent – DNA Polymerase
b) DNA dependent – DNA polymerase
c) DNA dependent – RNA polymerase
d) DNA ligase
Answer: c

Question: Polyploidy takes place in a cell when
a) If transcription takes place but cell division doesn’t take place
b) If replication takes place but transcription doesn’t take place
c) If replication takes place but cell division doesn’t take place
d) If replication and cell division doesn’t take place
Answer: c

Question: Transcription takes place on
a) Both the DNA strand simultaneously
b) Coding strand
c) Template strand
d) None of the above
Answer: c

Question: Long DNA replication takes place only within a small opening called replication fork because
a) Opening of whole DNA throughout the length needs a lot of time
b) Opening of whole DNA throughout the length needs a lot of energy
c) At one time in a cell only a small DNA part is replicated
d) None of these
Answer: b

Question: Why N15 isotope of nitrogen was taken in Stahl experiment?
a) It is radioactive
b) It is heavy than 14N– isotope and can be separated on the base of density
c) It can be separated based on radioactivity
d) Both (a) and (c)
Answer: b

Question: If newly transcribed RNA have sequence 5’AUUCGUA3’ the coding sequence will be
a) 5’CGGATT3’
b) 3’GCCTAA5’
c) 3’AATCCG5’
d) 5’ATTCGTA3’
Answer: d

Question: Transcription unit is located on
a) m RNA molecule
b) DNA molecule
c) r RNA molecule
d) t RNA molecule
Answer: b

Question: Taylor and colleagues in 1958 experimented on which plant for proving replication is semiconservative
a) Pisum sativum
b) Vicia fabia
c) Hibiscus rosasinesis
d) None of the above
Answer: b

Question: The average replication rate is around
a) 2000 bp/sec
b) 2 kbp/sec
c) 2 × 106 bp/sec
d) None of these
Answer: a

Question: RNA synthesis takes place on a single DNA strand because
a) Two strands have different sequences; transcribing both forms different proteins
b) The RNA strands from both would be complementary and form dsRNA
c) Both of these
d) None of these
Answer: c

Question: A sequence of DNA to be transcribed is 5’TTACCGAT–3’ coding strand 3’AATGGCTA–5’ template strand. What will be the sequence of transcribed mRNA?
a) UUACCGAU
b) AAUGGCUA
c) TTUGGCUT
d) All of these
Answer: a

Question: Enzymes that joins fragments of the DNA strand synthesized by discontinuous synthesis
a) Helicase
b) DNA ligase
c) DNA polymerase
d) Telomerase
Answer: b

Question: dNTPs importance in replication is
a) Serves as substrate
b) Activates polymerase
c) Gives energy for strand separation
d) Both (a) and (c)
Answer: d