CBSE Class 12 Biology HOTs Biotechnology Principles and Processes

Refer to CBSE Class 12 Biology HOTs Biotechnology Principles and Processes. We have provided exhaustive High Order Thinking Skills (HOTS) questions and answers for Class 12 Biology Chapter 9 Biotechnology Principles and Processes. Designed for the 2026-27 exam session, these expert-curated analytical questions help students master important concepts and stay aligned with the latest CBSE, NCERT, and KVS curriculum.

Chapter 9 Biotechnology Principles and Processes Class 12 Biology HOTS with Solutions

Practicing Class 12 Biology HOTS Questions is important for scoring high in Biology. Use the detailed answers provided below to improve your problem-solving speed and Class 12 exam readiness.

HOTS Questions and Answers for Class 12 Biology Chapter 9 Biotechnology Principles and Processes

Question. Why foreign DNA cannot pass through cell membrane?
(a) DNA is hydrophobic
(b) DNA is hydrophilic
(c) DNA is rich in proteins
(d) DNA is heavy
Answer : B

 

Question. Which of the following has popularised the PCR (polymerase chain reactions)?
(A) Easy availability of DNA template
(B) Availability of synthetic primers
(C) Availability of cheap deoxyribonucleotides
(D) Availability of ‘Thermostable’ DNA polymerase.
Answer : D

Question. Which of the following steps are catalysed by Taq polymerase in a PCR reaction?
(A) Denaturation of template DNA.
(B) Annealing of primers to template DNA.
(C) Extension of primer end on the template DNA.
(D) All of the above. 
Answer : C

Question. The role of DNA ligase in the construction of a recombinant DNA molecule is
(A) Formation of phosphodiester bond between two DNA fragments.
(B) Formation of hydrogen bonds between sticky ends of DNA fragments.
(C) Ligation of all purine and pyrimidine bases.
(D) None of the above 
Answer : A

Question. Consider the following statements and select the correct option.
(a) A soil inhabiting plant bacterium, Agrobacterium tumefaciens, a pathogen of several dicot plants is able to transfer a piece of DNA known as T-DNA
(b) The T-DNA causes tumours
(c) Tumour formation is induced by Ti plasmid
(d) All of the above
Answer : D

Question. Which of the following statement is incorrect?
(a) Each restriction endonuclease recognises a specific palindromic nucleotide sequence
(b) Specific base sequence is known as recognition sequence
(c) Restriction enzymes cannot cut DNA
(d) Restriction enzymes belong to enzymes called nucleases
Answer : C

Question. Which of the following statement is incorrect?
(a) EcoRI cuts the DNA between bases G and A
(b) Making multiple identical copies of any template DNA is called cloning
(c) pBR322 is a natural plasmid
(d) Agrobacterium tumefaciens is a natural genetic engineer
Answer : C

Question. Which of the following statements does not hold true for restriction enzyme?
(A) It recognises a palindromic nucleotide seq-uence.
(B) It is an endonuclease.
(C) It is isolated from viruses.
(D) It produces the same kind of sticky ends in different DNA Molecules. 
Answer : C

Question. Which of the following should be choosen for best yield if one were to produce a recombinant protein in large amounts?
(A) Laboratory flask of largest capacity.
(B) A stirred-tank bioreactor without in-lets and outlets.
(C) A continuous culture system.
(D) Any of the above.
Answer : C

Question. Choose the incorrect statement.
(a) Ori also controls the copy numbers of the linked DNA
(b) If a foreign DNA ligates at the Bam HI site of tetracycline resistance gene in the vector pBR322, the recombinant plasmid loses the tetracycline resistance due to insertion of foreign DNA
(c) Copy number refers to the number of copies of plasmid present in a cell
(d) Copy number of plasmid varies from 50-100 per cell
Answer : D

Question. Which of the statements given is incorrect?
(a) In microinjection method, foreign DNA is directly injected into the nucleus of animal cell by using microneedles
(b) Microinjection method is used in oocytes, eggs and embryo
(c) Electroporation is the formation of temporary pores in the plasma membrane of host cell by using lysozyme or calcium chloride
(d) In chemical mediated gene transfer method, certain chemicals such as Ca phosphate help foreign DNA to enter the host cell
Answer : C

Question. Consider the following statements.
I. RecombinantDNAtechnology popularly known as genetic engineering is a stream of biotechnology which deals with the manipulation of genetic material by manin vitro.
II. pBR322 is the first artificial cloning vector developed in 1977 by Boliver and Rodriquez from E. coli plasmid.
III. Restriction enzymes belong to a class of enzymes called nucleases.
Which of the statements given above are correct?
(a) I and II
(b) I and III
(c) II and III
(d) I, II and III
Answer : D

Question. Which of the given statement is correct in the context of observing DNA separated by agarose gel electrophoresis?
(A) DNA can be seen in visible light.
(B) DNA can be seen without staining in visible light.
(C) Ethidium bromide stained DNA can be seen in visible light.
(D) Ethidium bromide stained DNA can be seen under exposure to UV light. 
Answer : D

Question. Who among the following was awarded the Nobel Prize for the development of PCR technique?
(A) Herbert Boyer
(B) Hargovind Khurana
(C) Kary Mullis
(D) Arthur Kornberg
Answer : C

Question. Given below are four statements pertaining to separation of DNA fragments using gel electrophoresis. Identify the incorrect statements.
I. DNAis negatively charged molecule and so it is loaded on gel towards the anode terminal.
II. DNAfragments travel along the surface of the gel whose concentration does not affect movement of DNA.
III. Smaller the size ofDNAfragment larger is the distance it travels through it.
IV. PureDNAcan be visualised directly by exposing UV-radiation.
Select the correct option from the following.

(a) I, III and IV
(b) I, II and III
(c) II, III and IV
(d) I, II and IV
Answer : D

Question. The treatment of host cell with divalent cation leads to the
(a) change in permeability of DNA
(b) increased efficiency with which DNA enters the bacterium
(c) decreased efficiency with which DNA enters the bacterium
(d) change in permeability of host
Answer : B

Question. Which vector can clone only a small fragment of DNA?
(a) Bacterial artificial chromosome
(b) Yeast artificial chromosome
(c) Plasmid
(d) Cosmid
Answer : C

Question. The DNA used as a carrier for transferring a fragment of foreign DNA into a suitable host is called 
(a) cloning vector
(b) vehicle DNA
(c) gene carrier
(d) All of these
Answer : D

Question. Which of the following is a plasmid vector?
(a) pBR322
(b) Bam II
(c) SaI I
(d) Eco RI
Answer : A

Question. The method which is used to introduce recombinant DNA into animal cell?
(a) Gene gun method
(b) Changing permeability of host
(c) Biolistic method
(d) Microinjection
Answer : D

Question. Which of the following methods(s) is used to introduce foreign DNA into plant host cells?
(a) Gene gun method
(b) Gel electrophoresis
(c) Elution
(d) Extension
Answer : A

Question. For transformation, microparticles coated with DNA to be bombarded with gene gun are made up of
(a) silver or platinum
(b) platinum or zinc
(c) silicon or platinum
(d) gold or tungsten
Answer : D

Question. DNA transfer with high velocity micro particles is present in
(a) biolistics
(b) hybridisation
(c) tissue culture
(d) vegetative propagation
Answer : A

Question. The different steps involved in the process of recombinant DNA technology are given below randomly? Arrange these in correct order.
I. Extraction of the desired gene product.
II. Amplification of the gene of interest.
III. Isolation of a desiredDNAfragment.
IV. Ligation of theDNAfragment into a vector.
V. Insertion of recombinantDNAinto the host.
Correct order is
(a) I, II, III, IV and V
(b) III, II, IV, V and I
(c) II, IV, V, III and I
(d) I, IV, V, III and II
Answer : B

Question. In bacterial cells, the membrane is digested with the help of enzyme
(a) cellulase
(b) lysozyme
(c) chitinase
(d) lipase
Answer : B

Question. Primers are
(a) small chemically synthesised oligonucleotides of about 10-18 nucleotides that are complementary to the region of template DNA
(b) chemically synthesised oligonucleotides of about 10-18 nucleotides that are not complementary to the region of template DNA
(c) the double-stranded DNA that need to be amplified
(d) specific sequences present on recombinant DNA
Answer : A

Question. The Taq polymerase enzyme is obtained from
(a) Thiobacillus ferroxidans
(b) Bacillus subtilis
(c) Pseudomonas subtilis
(d) Thermus aquaticus
Answer : D

Question. A single PCR amplification cycle involves
(a) denaturation
(b) extension
(c) annealing
(d) All of these
Answer : D

Question. In gel electrophoresis, restriction enzyme digested DNA is loaded in wells near
(a) anode
(b) cathode
(c) centre of gel
(d) any where in the gel
Answer : B

Question. Stirred-tank bioreactors are advantageous over shake flasks because they
(a) provide high temperature and pH
(b) provide better aeration and mixing properties
(c) do not allow the entry of CO2
(d) are easy to operate
Answer : B

Question. The components of a bioreactor are
I. an agitator system.
II. an oxygen delivery system.
III. foam control system.
IV. temperature control system.
V. pH control system.
VI. sampling ports towithdrawcultures periodically.
Choose the correct option.
(a) I, II, III, IV and V
(b) II, IV, V and VI
(c) I, II, III, IV and VI
(d) All of these
Answer : D

Question. The process of separation and purification of expressed protein before marketing is called
(a) upstream processing 
(b) downstream processing
(c) bioprocessing
(d) post-production processing
Answer : B

Question. Which of the following is not a component of downstream processing?
(a) Separation
(b) Purification
(c) Preservation
(d) Expression
Answer : D

I. Assertion and Reason
In each of the following questions, a statement of Assertion (A) is given followed by corresponding statement of Reason (R). Of the statements, mark the correct answer as
(a) If both A and R are true and R is the correct explanation of A
(b) If both A and R are true, but R is not the correct explanation of A
(c) If A is true, but R is false
(d) If A is false, but R is true

Question. Assertion (A) Biotechnology deals with techniques that use living organism to produce products useful for humans.
Reason (R) It uses only a unicellular organism.
Answer : C

Question. Assertion (A) Maintenance of sterile environment is essential for manufacture of biotechnological products.
Reason (R) This is to enable growth of desired prokaryotic or eukaryotic cells.
Answer : A

Question. Assertion (A) Origin of replication is an essential part of a vector.
Reason (R) Ori is responsible for initiating replication.
Answer : A

Question. Assertion (A) Foreign DNA and vector DNA cut with the help of ligase.
Reason (R) Ligase acts by forming phosphodiester bonds.
Answer : D

Question. Assertion (A) In gel electrophoresis, DNA fragments are separated.
Reason (R) DNA is negatively charged, so it moves towards anode under electric field.
Answer : A

Question. Assertion (A) Restriction endonucleases are also called ‘molecular scissors’.
Reason (R) When fragments generated by restriction endonucleases are mixed, they join together due to their sticky ends.
Answer : B

Question. Assertion (A) All endonucleases cut DNA at specific sites.
Reason (R) Endonucleases were discovered from viruses.
Answer : C

Question. Assertion (A) The tumour inducing plasmid (Ti plasmid) of Agrobacterium tumefaciens acts as a cloning vector in recombinant DNA technology.
Reason (R) The Ti plasmid which is used in the mechanisms of delivering genes to a cell remains pathogenic.
Answer : C

Question. Assertion (A) Use of chitinase enzyme is necessary for isolation of DNA from fungal cells.
Reason (R) Fungal cell wall is made up of chitin and chitinase is able to digest it.
Answer : A

Statement Based Questions

Question. Which one is a true statement regarding DNA polymerase used in PCR?
(a) It is used to ligate introduced DNA in recipient cells
(b) It serves as a selectable marker
(c) It is isolated from a virus
(d) It remains active at high temperature
Answer : D

Question. Following statements describe the characteristics of the enzyme restriction endonulease. Identify the incorrect statement. NEET 2019
(a) The enzyme binds DNA at specific sites and cuts only one of the two strands
(b) The enzyme cuts the sugar-phosphate backbone at specific sites on each strand
(c) The enzyme recognises a specific palindromic nucleotide sequence in the DNA
(d) The enzyme cuts DNA molecules at identified position within the DNA
Answer : A

Question. Which of the following statement is incorrect?
(a) Nucleic acid is fragmented by nucleases
(b) Construction of recombinant DNA involves cleaning DNA segments with endonuclease and rejoining with ligase
(c) Genetic engineering is making artificial limbs and diagnostic instruments
(d) Ti plasmid transforms cells of plants
Answer : C

Question. Which of the following statement is incorrect?
(a) DNA being a hydrophilic molecule cannot pass through cell membranes
(b) Agrobacterium tumefaciens delivers a piece of DNA known as ‘Z-DNA’ which transforms normal plant cells into tumour cells and directs these tumour cells to produce chemicals against pathogens
(c) Retrovirus, adenovirus, papillomavirus are also now used as cloning vectors in animal because of their ability to transform normal cells into cancerous cell
(d) In genetic engineering, DNA from different sources are cut with the same restriction enzymes so that both DNA fragments have same kind of sticky ends
Answer : B

 
Q.1 
CBSE_Class_12_Biology_Biotechnology_&_its_Application_1
 
Ans.1
CBSE_Class_12_Biology_Biotechnology_&_its_Application_2
Q.2
CBSE_Class_12_Biology_Biotechnology_&_its_Application_3
 
Answer the questions from the figure given
i) W rite the name of the enzyme required for PCR.
ii) From which organism it is obtained?
Iii) What is the significance of this enzyme ?
 
Ans.i)Taq polymrrase
     ii)Thermus aquaticus
     iii) Thermostable
 
Q3. Match the following
                  A                                                                         B
          i) Bacteria                                                             i) Celluase
ii) Chitinase                                           ii)Microparticles of gold or tungsten coated with DNA
iii) Plant cell                                                                  iii) Microinjection
iv) Recombinant DNA injected
to nucleus of an animal cell                                             iv) Lysozyme
v) Biolistic /Gene gun                                                       v) Fungus
 
Ans  Match the following
                  A                                                                         B
Bacteria --- ----------------------                                         Lysozyme
Chitinase ---------------------                                                Fungus
Biolistic /Gene gun -----------                        Microparticles of gold or tungsten coated with DNA
Plant cell ---------------------                            Celluase Recombinant DNA injected to
nucleus of an animal cell ------ ------                                  Microinjection
 
Q4. Write the pallinodromic sequence of the following     5'-------GAATTC--------3'
 
Ans.4 3'------CTTAAG-------5'
 
Q5
CBSE_Class_12_Biology_Biotechnology_&_its_Application_4
i)What dose the fig shows?
ii)What is the matrix used for the above process?
Iii)Name the chemical compound used for staining?
iv)Name the process for the separation of DNA from the agarose gel.
 
Ans. i) Agarose gel electrophoresis ii) Agarose
iii) Ethidium bromide
iv) Elution

Q.1. Agrobacterium tumefaciens is called natural genetic engineer. It infects only dicot plants. Unfortunately, many important crop plants, including corn, rice, and wheat, are monocots and thus could not be easily transfected using this bacterium. Scientists discovered that by using certain processes, naked DNA molecules can be introduced into plant cell types that are not susceptible to A. tumefaciens transfection. Explain any two.

 
Ans1. a. Micro-injection where r-DNA is directly injected into the nucleus of the host cell.
b. Cells are bombarded with high velocity micro-particles of gold or tungsten coated with the desired gene with its operating system ( Biolistics /gene gun ).
 
Q.2 Each restriction enzyme cuts DNA at a specific base sequence. For example, EcoRI always cuts DNA at GAATTC
3’—GTAAGAATTCTTTAGAATTCCGCCATTATCGAATTCAGGATCTTAC—5’
5’—CATTCTTAAGAAATCTTAAGGCGGTAATAGCTTAAGTCCTAGAATG—3’
a. How many times EcoRI cuts this long strand?
b. How many small DNA pieces are formed from this long strand?
c. These fragments show overhangs of single stranded DNA. What are they known as? Why are they called so?
d. Which enzyme is used to seal these fragments together?
 
Ans2. a. Three cuts.
b. Four strands.
c. Sticky ends, since they have complementary bases, they can rejoin fragments with complementary sticky ends to form rDNA (gene from vector and the gene to be cloned is inserted)
d. DNA ligase
 
Q.3. Any DNA flanked at its two borders by T-DNA can be integrated into the plant genome. Name the vector used for this plant gene transfer?
 
Ans.3. Tumor inducing plasmids (Ti Plasmids)
 
Q.4. A dicot leaf is punched and is incubated in a suspension of soil bacteria. The cells on the edge of the punch are transformed and developed into new plants through tissue culture.
a. Name the technology.
b. Name the soil bacteria responsible for this transformation.
 
Ans.4. a. DNA recombinant technology
b. Agro bacterium termifaciens- a natural genetic engineer.
 
Q.5. Dicot plants do show tumorous growth (crown gall disease) on the stem.
a. Name the microorganism responsible for this growth?
b. What causes the production of tumors?
 
Ans5. a. Agro bacterium termifaciens
    b. The transfer of bacterial DNA to the plant which integrates into the plant genome and produces hormones for the over growth
 
Q.6. In Gel electrophoresis, the DNA fragments are placed in wells on a sheet of gelatin and an electric current is applied to the sheet. Based on DNA biochemistry in which side are the wells located? In which direction and why do the fragments migrate?
 
Ans 6. DNA is loaded on the cathode side of the gel. Since DNA is negatively charged the fragments move towards positive pole (anode) when the electric field is applied.
 
Q.7. Agrobacterium tumifaciens is a pathogen of several dicot plants. But for biotechnologists it is a boon. Justify?
 
Ans7. It is considered as a natural genetic engineer. The Ti-plasmid of the bacterium is modified and used as a cloning vector to deliver the genes of our interest into a variety of plants.
 
Q.8. Suppose you want to make a billion copies of a small region of the chromosome in vitro, which biotechnological mechanism will you prefer? Name the three main steps involved?
 
8. Polymerase chain reaction to amplify gene of interest.
(i) Denaturation
(ii) Annealing
(iii) Extension
 
Q.9. A foreign DNA fragment is introduced into the plasmid at the ‘Bam H-1’ site of the tetracycline resistant gene in the vector ‘pBR 322’.
a) How does it affect the recombinant plasmid?
b) What is this mechanism known as?
c) Mention its advantages?
 
Ans9. a. Due to insert the recombinant plasmids loose the tetracycline resistance.
    b. Insertional inactivation.
    c. To select recombinants from non-recombinants.
 
Q.10. In nature A. tumifaciens which is called a natural genetic engineer, infects only dicots. Unfortunately many important crop plants are monocots and thus could not be easily transfacted. Scientists have discovered certain processes to introduce naked DNA molecules into the plant tissue that are not susceptible to A. tumefactions ? Explain any two.
 
Ans10 For explanation refer text book.
      a. Micro-injection
      b. Biolistics
 
Q.11. In making bacteria as a competent host for transformation with r-DNA, it is treated with a specific concentration of divalent cation like calcium. What is the role of calcium?
 
Ans11. Creates pores in its cell wall
 
Q.12. After completion of the biosynthetic stage the products has to be subjected through a series of processes before it is ready for marketing.
a) List these processes?
b) What are they collectively known as?
c) List any other measures to be taken care of?
 
Ans12.a. Separation, purification
    b. Downstream processing
    c. Quality control testing
 
Q.13. Traditional hybridization procedures used in plant and animal breeding very often leads to inclusion and multiplication of undesirable genes along with the desirable ones. What are the steps involved in genetic engineering to over come this limitation?
 
Ans13 (i) Gene cloning
(ii) Gene transfer
 
Q.14. Selection of recombinants due to inactivation of antibiotics is a cumbersome procedure. Why? Explain the alternative method to overcome this difficulty?
 
Ans14(i) It requires simultaneous planting on two plants having different antibiotics.
(ii) Development & use of selectable marker which differentiate recombinats from nonrecombinats on the basis of there ability to produce colour in the process of a chromogenic substance.
 
15. Following figures show a biotechnological Procedure which requires template DNA strand, primers, DNA polymerase, and nucleotides.
a..Name the procedure.
b.List and explain the steps shown in figures 2 - 5
CBSE_Class_12_Biology_Principles_&_Processes_1
Ans15(i) Polymerase chain reaction to amplify gene of interest
(ii) fig. 2 – Denaturation-DNA is heated appox..95oC to separate the two stands of the double helix.
(iii) Fig.3. Attachment of the primers & then polymerize after cooling annealing.
(iv) Fig .3 Extension & amplification

 

Q.1Restriction Enzymes are called “Molecular scissors”. In what context they are referred so?
 
Ans 1.Theycut DNA molecules at specific sites and then fragment
 
Q.2 In what way the following two plasmids differ? 1
CBSE_Class_12_Biology_Principles_And_Processes_1
Ans2 a- non recombinat b. recembinqat
 
Q.3. What is the source of thermostable DNA polymerase and Name that polymerase. Why thermostable DNA polymerase is essential in PCR? 1
 
Ans3 Bacteria – Thermus aquaticus: Taq polymerase: During Denaturation in PCR high temperature is required and thermostable DNA polymerase remains stable in that high temperature.
 
Q.4 “The prophase I of meiosis plays a vital role in r-DNA formation” Justify the statement.1

Ans4 crossing over occurs in this phase helps to produce recombinants.
 
Q.5 Eukaryotes do not have restriction endonuclease, then how they manage with normal endonuclease enzyme?1
 
Ans5 I n Eukaryotes, normal endonuclease attach with special proteins, like initiator, terminator, Snrbs etc. to perform their functions.
 
Q.6What special feature do prokaryotes have to defend themselves from bacteriophages?1
 
Ans6 .Restriction Endonuclease enzyme.
 
Q.7_____= Denaturation +______+Extenton.1
 
Ans7 .PCR, Annealing.
 
Q.8.Complete the following palindrome sequence and name the restriction endonuclese that recognises this.1
CBSE_Class_12_Biology_Principles_And_Processes_2
Ans.8
CBSE_Class_12_Biology_Principles_And_Processes_3
2 MARKS
 
Q.1) Is advisable to use different restriction endonucleases to cut the vector DNA and source DNA? Why? 2
 
Ans1) No, when cut with the same restriction enzyme, only the resultant DNA fragments have the same sticky ends and these can be joined together using DNA ligases.
 
Q 2) What will happen if more than one recognition sites are present in a vector?2
 
Ans2) Presence of more than one recognition sites within the vector will generate several fragments, which will complicate gene cloning.
 
1. These are enzymes called restriction enzyme found in bacteria and are used to cut pieces of DNA
 
2. These are organisms that are used to transfer a gene of interest to a host. Eg: plasmid, virus, and bacteria.
 
Q.3 Uncontrolled recombinant DNA technology experiments is dangerous to mankind. Comment on it.
 
Ans 3. The palindrome in DNA is a sequence of base pains that read same on the two strands when orientation of reading is kept same. E.g.
 
5’ – GAATTC – 3’
3 – CTTAAG – 5
 
Q.4
 
  CBSE_Class_12_Biology_Principles_And_Processes_4.
Ans 4
CBSE_Class_12_Biology_Principles_And_Processes_5
Q.5. (a) Which is the most commonly used matrix in gel electrophoresis ?
       (b) What is the source of it?
 
Ans.5(a) Agrose.
         (b) Sea weed-Gelidium sp.
 
Q.6 Find the ‘odd one out and write why that is ‘odd’
      (a) Sal I, Pst I, Cla I, BamH I, pBR 322
      (b) Bacteria, Virus, Gene-gun, Fungi
 
Ans.6 (a) pbr 322, it is a plasmid-vector; others restriction enzymes in the plasmid.
          (b) gene-gun- it is a device used for direct introduction of a gene in a host cell.
 
Q.7 Detect the mismatch from the following and replace the wrong match with a right one
(a) ECOR I –Bacteria
(b) Ethidium Bromidqe- Gel electrophoresis
(c) Lysozyme- Fungi
(d) Palindrome sequence-Restriction enzyme
Resistant gene.
(b)Cellulose,__________,__________,fungus
 
Ans.7 Lysosome -fungi,.(lysozyme is the enzyme to related to bacteria and not fungi)
 
Q.8.Write the use of the following in Biotechnology.
 
       (a) Chilled ethanol       
           
       (b) Microinjection
 
       (c) Bioreactor
 
       (d) plasmid
 
Ans.8. (a) added to precipitate the purified DNA to isolate it.
 
         (b) microinjection- to inject the foreign gene into a host cell, directly.
 
         (c) set up to culture large volumes of transgenic bacteria to get large quantities of the product protein.
 
         (d) plasmid- the vector to transform a foreign gene.
 
Q.9. Is there any difference between recombinant DNA and recombinant protein? Support your answer.
 
Ans.9. Yes, r-DNA = plasmid(vector) + foreign DNA
          r-protein is the product of transgenic gene in the host body /cell.
 
3 MARKS
Q.1. Give the correct term for the following; -
 
(a) Replacing a defective mutant allele with a normal functional allele / gene.
 
(b) Increasing the copies (content) of a gene
 
(c) Preventing m-RNA translation
 
(d) Specific pattern of base pairs that are recognized by restriction enzymes.
 
(e) Mobile genetic element
 
(f) One DNA copies itself and produces two
 
Ans.1.(a) gene therapy
 
        (b) amplification
 
        (c) RNA interference
 
        (d) palindronic sequence
 
        (e)transposones
 
        (f) DNA replication
 
Q.2. Name the enzyme involved in the following process:
 
(a) Repeated amplification of DNA fragments.
 
(b) Formation of short piece of RNA strand for annealing.
 
(c) Breaking of bacterial cell to release DNA and other macromolecules.
 
(d) Cutting and rejoining DNA fragments.
 
(e) Formation of m-RNA.
 
Ans.2. (a) tag polymerase (DNA polymerase )
 
    (b) primase
 
    (c) lysozyme
 
   (d) topoisomerse
 
   (e)RNA- polymersease
 
   (f) DNA ligase

3 (a) Linking a foreign DNA with a plasmid(vector)
(b) DNA formed by a RNA by Reverse Transciption.
(c) ds RNA- complementary RNA
4.E.coli cloning vector
(a) ori
(b) rop
(c) ECOR I
(d) ampR
(e) tetR

5MARKS
.1. (a) “Insertional inactivation”
In this recombinants & non recombinants are differentiated on the basis of the ability to produce colour in the presence of a chromosomic substrate – In this, a rDNA is inserted
in an enzyme – α galactosidase – leads to inactivation of the enzyme which does not produce colour due to insertion.
(b)
(i) Host cells are incubated with rDNA on ice.
(ii) Followed by placing them briefly at 410C heat.
(iii) Then transforming them back on ice.
This enables the host cells (bacteria) to take up the rDNA.

HOTS for Chapter 9 Biotechnology Principles and Processes Biology Class 12

Students can now practice Higher Order Thinking Skills (HOTS) questions for Chapter 9 Biotechnology Principles and Processes to prepare for their upcoming school exams. This study material follows the latest syllabus for Class 12 Biology released by CBSE. These solved questions will help you to understand about each topic and also answer difficult questions in your Biology test.

NCERT Based Analytical Questions for Chapter 9 Biotechnology Principles and Processes

Our expert teachers have created these Biology HOTS by referring to the official NCERT book for Class 12. These solved exercises are great for students who want to become experts in all important topics of the chapter. After attempting these challenging questions should also check their work with our teacher prepared solutions. For a complete understanding, you can also refer to our NCERT solutions for Class 12 Biology available on our website.

Master Biology for Better Marks

Regular practice of Class 12 HOTS will give you a stronger understanding of all concepts and also help you get more marks in your exams. We have also provided a variety of MCQ questions within these sets to help you easily cover all parts of the chapter. After solving these you should try our online Biology MCQ Test to check your speed. All the study resources on studiestoday.com are free and updated for the current academic year.

FAQs

Where can I download the latest PDF for CBSE Class 12 Biology HOTs Biotechnology Principles and Processes?

You can download the teacher-verified PDF for CBSE Class 12 Biology HOTs Biotechnology Principles and Processes from StudiesToday.com. These questions have been prepared for Class 12 Biology to help students learn high-level application and analytical skills required for the 2026-27 exams.

Why are HOTS questions important for the 2026 CBSE exam pattern?

In the 2026 pattern, 50% of the marks are for competency-based questions. Our CBSE Class 12 Biology HOTs Biotechnology Principles and Processes are to apply basic theory to real-world to help Class 12 students to solve case studies and assertion-reasoning questions in Biology.

How do CBSE Class 12 Biology HOTs Biotechnology Principles and Processes differ from regular textbook questions?

Unlike direct questions that test memory, CBSE Class 12 Biology HOTs Biotechnology Principles and Processes require out-of-the-box thinking as Class 12 Biology HOTS questions focus on understanding data and identifying logical errors.

What is the best way to solve Biology HOTS for Class 12?

After reading all conceots in Biology, practice CBSE Class 12 Biology HOTs Biotechnology Principles and Processes by breaking down the problem into smaller logical steps.

Are solutions provided for Class 12 Biology HOTS questions?

Yes, we provide detailed, step-by-step solutions for CBSE Class 12 Biology HOTs Biotechnology Principles and Processes. These solutions highlight the analytical reasoning and logical steps to help students prepare as per CBSE marking scheme.