NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance

Scroll down for PDF

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance. The NCERT solutions for Class 11 Mathematics have been made by Mathematics teacher of one of the best CBSE school in India. These NCERT solutions have been made to give detailed answers and expanations of the concepts as per NCERT which can be easily understood by the students. Refer to other links also to download mathematics NCERT solutions, worksheets, sample papers and Exemplar Solutions. 

Class 12 Biology

NCERT Solutions

Chapter 6 Molecular Basis of Inheritance

1.Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine,Guanosine, Uracil and Cytosine.

Ans. Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2.If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Ans. In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:

5′-ATGCATGCATGCATGCATGCA

TGCATGC-3′

Write down the sequence of complementary strand in 5′ -> 3′ direction.

Ans. 5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

4.If the sequence of the coding strand in a transcription unit is written as follows: 5-

ATGCATGCATGCATGCATGCA TGCATGC-3′ Write down the sequence of mRNA.

Ans. mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5.Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans. Complementary base pairing property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of double helix of DNA molecule. Such an arrangement of DNA molecule led them to hypothesize the semi conservative mode of replication of DNA.

Please click the link below to download NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance.

Tags: 


Click on the text For more study material for Biology please click here - Biology

Latest NCERT & CBSE News

Read the latest news and announcements from NCERT and CBSE below. Important updates relating to your studies which will help you to keep yourself updated with latest happenings in school level education. Keep yourself updated with all latest news and also read articles from teachers which will help you to improve your studies, increase motivation level and promote faster learning

CBSE examination board hike the fee for class 10th and 12th

The CBSE (Central Board Secondary Education) increased the examination fees for classes 10 and 12 of the 2020 boards, with no profit no loss principle, from Rs. 750 to Rs 1500, for all categories of students, including SC/ST candidates for all schools throughout India...

CBSE to conduct a voluntary test for class 11th and 12th

Nowadays students have the liberty to choose the field they seem to fit in. A few years back the problem was parents who burdened children with their own choices. On the other side, now students along with their parent's support are free to choose their field. Not any...

Seven Motivational tips for every student

If you’re are a student or a learner and you doesn’t feel like study then this article is going to be very important for you, Reading constantly and Staying motivated as a student is one of the most challenging tasks and barriers to educational success. Education is...

JEE in Punjabi too after English, Hindi and Gujarati

Punjab Minister Tript Rajinder Singh Bajwa requested the joint technology entrance exam (main) to be conducted in Punjabi and other regional languages too. In his letter to Union HRD Minister Ramesh Pokhriyal Nishank, the Punjab Minister for Higher Education and...

Extension of dates by CBSE for Single Girl Child Merit (SGC) scholarship

CBSE has announced to extend dates for SGC scholarship. Previously the dates to submit the SGC scholarship form were 18 October 2019. Now dates have shifted. For online submission, the last date is 31st October. Whereas date for submission of hard copies of renewal...

JEE Entrance Exam 2020 Dates Registration Admit Cards Exam Pattern

JEE Entrance exam is conducted for students who wish to pursue engineering in different subjects or categories like mechanical, CS, etc.. It is officially organized and conducted by NTA. Formerly it was organized by CBSE. It avails seats for students in IITs, NITs, and...

×
Studies Today