NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance. The NCERT solutions for Class 11 Mathematics have been made by Mathematics teacher of one of the best CBSE school in India. These NCERT solutions have been made to give detailed answers and expanations of the concepts as per NCERT which can be easily understood by the students. Refer to other links also to download mathematics NCERT solutions, worksheets, sample papers and Exemplar Solutions. 

Class 12 Biology

NCERT Solutions

Chapter 6 Molecular Basis of Inheritance

1.Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine,Guanosine, Uracil and Cytosine.

Ans. Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2.If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Ans. In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:

5′-ATGCATGCATGCATGCATGCA

TGCATGC-3′

Write down the sequence of complementary strand in 5′ -> 3′ direction.

Ans. 5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

4.If the sequence of the coding strand in a transcription unit is written as follows: 5-

ATGCATGCATGCATGCATGCA TGCATGC-3′ Write down the sequence of mRNA.

Ans. mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5.Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans. Complementary base pairing property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of double helix of DNA molecule. Such an arrangement of DNA molecule led them to hypothesize the semi conservative mode of replication of DNA.

Please click the link below to download NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance.

Tags: 

 


Click to View or Download pdf file
Click for more Biology Study Material

Latest NCERT & CBSE News

Read the latest news and announcements from NCERT and CBSE below. Important updates relating to your studies which will help you to keep yourself updated with latest happenings in school level education. Keep yourself updated with all latest news and also read articles from teachers which will help you to improve your studies, increase motivation level and promote faster learning

Online Teacher Training Course on Competency based Education in DIKSHA

Competency is a set of skills, abilities, knowledge that helps an individual perform a given task in real life. Every learning should go into the imbibing of these skills to lead a productive and joyful life. The NATIONAL EDUCATION POLICY-2020 calls for shift towards...

Conduct of the practical work during the lockdown

CBSE has advised schools to follow the Alternative Calendar developed by NCERT to continue education during the lockdown through alternative modes to achieve learning outcomes. Schools have reportedly started using these calendars and other prescribed pedagogical...

Training of CBSE School Teachers on Olabs

Training of CBSE School Teachers on Olabs in collaboration with C-DAC Mumbai: OLabs is a platform jointly developed by the Ministry of Electronics and Telecommunications, Government of India, CDAC, and Amrita University to facilitate a virtual experience of CBSE...

National Online Painting Championship

The National Mission for Clean Ganga, Ministry of Jal Shakti in collaboration with Kalantar Art Trust is organizing KALANTAR-2020: National Online Painting Championship with the aim to provide a platform to youth and school children to demonstrate their artistic skills...

Revised SOP preventive measures followed while conducting examinations

Revised SOP on preventive measures to be followed while conducting examinations to contain spread of COVID-19 issued by Ministry of Health & Family Welfare Examination centres are frequented by large number of students (as well as their parents) and staff till the...

NEP Transforming India Quiz

As a part of Shikshak Parv celebration, an online quiz competition on National Education Policy 2020 will be organized by the Ministry of Education, Govt. of India, from 5 th September to 25th September 2020 in order to create awareness about NEP among all stakeholders...

×
Studies Today