NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance with answers available in Pdf for free download. The NCERT Solutions for Class 12 Biology with answers have been prepared as per the latest syllabus, NCERT books and examination pattern suggested in Standard 12 by CBSE, NCERT and KVS. Solutions to questions given in NCERT book for Class 12 Biology are an important part of exams for Grade 12 Biology and if practiced properly can help you to get higher marks. Refer to more Chapter-wise Solutions for NCERT Class 12 Biology and also download more latest study material for all subjects

Chapter 6 Molecular Basis of Inheritance Class 12 NCERT Solutions

Class 12 Biology students should refer to the following NCERT questions with answers for Chapter 6 Molecular Basis of Inheritance in standard 12. These NCERT Solutions with answers for Grade 12 Biology will come in exams and help you to score good marks

Chapter 6 Molecular Basis of Inheritance NCERT Solutions Class 12

NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance. The NCERT solutions for Class 11 Mathematics have been made by Mathematics teacher of one of the best CBSE school in India. These NCERT solutions have been made to give detailed answers and expanations of the concepts as per NCERT which can be easily understood by the students. Refer to other links also to download mathematics NCERT solutions, worksheets, sample papers and Exemplar Solutions. 

Class 12 Biology

NCERT Solutions

Chapter 6 Molecular Basis of Inheritance

1.Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine,Guanosine, Uracil and Cytosine.

Ans. Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2.If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

Ans. In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:

5′-ATGCATGCATGCATGCATGCA

TGCATGC-3′

Write down the sequence of complementary strand in 5′ -> 3′ direction.

Ans. 5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

4.If the sequence of the coding strand in a transcription unit is written as follows: 5-

ATGCATGCATGCATGCATGCA TGCATGC-3′ Write down the sequence of mRNA.

Ans. mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5.Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans. Complementary base pairing property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of double helix of DNA molecule. Such an arrangement of DNA molecule led them to hypothesize the semi conservative mode of replication of DNA.

Please click the link below to download NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance.

Tags: 

 


Click to View or Download pdf file
Click for more Biology Study Material
Chapter 1 Reproduction in Organisms
NCERT Solutions Class 12 Biology Chapter 1 Reproduction in Organisms
Chapter 2 Sexual Reproduction In Flowering Plants
NCERT Solutions Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants
Chapter 3 Human Reproduction
NCERT Solutions Class 12 Biology Chapter 3 Human Reproduction
Chapter 4 Reproductive Health
NCERT Solutions Class 12 Biology Chapter 4 Reproductive Health
Chapter 5 Principles of Inheritance and Variation
NCERT Solutions Class 12 Biology Chapter 5 Principles of Inheritance and Variation
Chapter 6 Molecular Basis of Inheritance
NCERT Solutions Class 12 Biology Chapter 6 Molecular Basis of Inheritance
Chapter 7 Evolution
NCERT Solutions Class 12 Biology Chapter 7 Evolution
Chapter 8 Human Health and Diseases
NCERT Solutions Class 12 Biology Chapter 8 Human Health and Disease
Chapter 9 Strategies for Enhancement In Food Production
NCERT Solutions Class 12 Biology Chapter 9 Strategies for Enhancement in Food Production
Chapter 10 Microbes In Human Welfare
NCERT Solutions Class 12 Biology Chapter 10 Microbes in Human Welfare
Chapter 11 Biotechnology Principles and Processes
NCERT Solutions Class 12 Biology Chapter 11 Biotechnology Principles And Processes
Chapter 12 Biotechnology and Its Application
NCERT Solutions Class 12 Biology Chapter 12 Biotechnology and its Applications
Chapter 13 Organisms and Populations
NCERT Solutions Class 12 Biology Chapter 13 Organisms and Populations
Chapter 14 Ecosystem
NCERT Solutions Class 12 Biology Chapter 14 Ecosystem
Chapter 15 Biodiversity and Conservation
NCERT Solutions Class 12 Biology Chapter 15 Biodiversity and Conservation
Chapter 16 Environmental Issues
NCERT Solutions Class 12 Biology Chapter 16 Environmental Issues

Latest NCERT & CBSE News

Read the latest news and announcements from NCERT and CBSE below. Important updates relating to your studies which will help you to keep yourself updated with latest happenings in school level education. Keep yourself updated with all latest news and also read articles from teachers which will help you to improve your studies, increase motivation level and promote faster learning

CBSE Board Examination Scheme of Assessment 2021 2022

A. Academic session to be divided into 2 Terms with approximately 50% syllabus in each term: The syllabus for the Academic session 2021-22 will be divided into 2 terms by following a systematic approach by looking into the interconnectivity of concepts and topics by...

How To Solve Unseen Passages In English

Unseen passages may contain one or many paragraphs. This is one of the important yet easy parts for a student to get marks. Students should thoroughly study and understand the passage to answer the related questions. The unseen passages are there just to test the...

CBSE Class 10 Revised Syllabus

Last year CBSE had to reduce the syllabus because of the pandemic situation but it was not very effective because there were no examinations. This year to avoid any confusion and conflict, CBSE has decided to reduce the syllabus into term 1 and term 2. 50 percent of...

MCQ Question based CBSE examination

For 2021-22 CBSE has launched MCQ question-based examination for Term 1 & Term 2 board examinations. The entire syllabus has been divided into two parts each including 50% of the entire syllabus. To score well, students must practice as per the new CBSE term-wise...

Score well in Class 12 English Boards Exam

12th Board exams are an important part of students' lives. The marks obtained in the board exam decide the college in which one can study. In class 12 the syllabus of each and every subject increases vastly and it is difficult to cover up every point. In English also...

Moderation of Marks Class 11 and 12 Board Exams

The portal for moderation and finalization of results for Class-12 is being opened from 16.07.2021 to 22.07.2021. As Board has to declare the result latest by 31.07.2021, schools have been requested to follow the schedule strictly and complete the moderation within...

×
Studies Today